ToolAssay

Slides each caller-supplied spacer over a bounded phage sequence in both orienta

Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability.

Answeringour last check, 2026-09-24
1 of 1checks answered this week
882 msmedian answer time
$0.004listed price per call
$0.004price it asked us

Paid test badge: not yet. The checks above are free: we call the tool without paying and read the payment request it sends back. The Verified badge needs paid calls whose answers match the promised output, and nobody can buy a badge.

Endpoint

POST https://bio.halowerk.com/v1/phage-matching

CategoryEverything else
Provider hostbio.halowerk.com
Networkseip155:8453
Payment schemesexact
Self-reported calls, 30 days1 from 1 payers (the provider's figure, not ours)

Our checks, last 30 days

DayResultHTTPAskedTime
2026-09-24 valid payment request 402$0.004 882 ms

Example input (from the provider)

{
  "body": {
    "max_mismatches": 2,
    "phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA",
    "spacers": [
      {
        "id": "spacer-1",
        "sequence": "GGCTAACCGTTCGATC"
      },
      {
        "id": "spacer-2",
        "sequence": "ATGCCTGAATTCGGCA"
      }
    ]
  },
  "bodyType": "json",
  "method": "POST",
  "type": "http"
}

Promised output schema (from the provider)

{
  "$schema": "https://json-schema.org/draft/2020-12/schema",
  "properties": {
    "input": {
      "additionalProperties": false,
      "properties": {
        "body": {
          "additionalProperties": false,
          "properties": {
            "max_mismatches": {
              "maximum": 5,
              "minimum": 0,
              "type": "integer"
            },
            "phage_sequence": {
              "maxLength": 10000,
              "minLength": 1,
              "pattern": "^[ACGT]+$",
              "type": "string"
            },
            "spacers": {
              "items": {
                "additionalProperties": false,
                "properties": {
                  "id": {
                    "maxLength": 128,
                    "minLength": 1,
                    "type": "string"
                  },
                  "sequence": {
                    "maxLength": 60,
                    "minLength": 15,
                    "pattern": "^[ACGT]+$",
                    "type": "string"
                  }
                },
                "required": [
                  "id",
                  "sequence"
                ],
                "type": "object"
              },
              "maxItems": 50,
              "minItems": 1,
              "type": "array"
            }
          },
          "required": [
            "phage_sequence",
            "spacers",
            "max_mismatches"
          ],
          "type": "object"
        },
        "bodyType": {
          "enum": [
            "json",
            "form-data",
            "text"
          ],
          "type": "string"
        },
        "method": {
          "enum": [
            "POST",
            "PUT",
            "PATCH"
          ],
          "type": "string"
        },
        "type": {
          "const": "http",
          "type": "string"
        }
      },
      "required": [
        "type",
        "method",
        "bodyType",
        "body"
      ],
      "type": "object"
    }
  },
  "required": [
    "input"
  ],
  "type": "object"
}

This page as JSON