Slides each caller-supplied spacer over a bounded phage sequence in both orienta
Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability.
Answeringour last check, 2026-09-24
1 of 1checks answered this week
882 msmedian answer time
$0.004listed price per call
$0.004price it asked us
Paid test badge: not yet. The checks above are free: we call the tool without paying and read the payment request it sends back. The Verified badge needs paid calls whose answers match the promised output, and nobody can buy a badge.
Endpoint
POST https://bio.halowerk.com/v1/phage-matching
| Category | Everything else |
|---|---|
| Provider host | bio.halowerk.com |
| Networks | eip155:8453 |
| Payment schemes | exact |
| Self-reported calls, 30 days | 1 from 1 payers (the provider's figure, not ours) |
Our checks, last 30 days
| Day | Result | HTTP | Asked | Time |
|---|---|---|---|---|
| 2026-09-24 | valid payment request | 402 | $0.004 | 882 ms |
Example input (from the provider)
{
"body": {
"max_mismatches": 2,
"phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA",
"spacers": [
{
"id": "spacer-1",
"sequence": "GGCTAACCGTTCGATC"
},
{
"id": "spacer-2",
"sequence": "ATGCCTGAATTCGGCA"
}
]
},
"bodyType": "json",
"method": "POST",
"type": "http"
}
Promised output schema (from the provider)
{
"$schema": "https://json-schema.org/draft/2020-12/schema",
"properties": {
"input": {
"additionalProperties": false,
"properties": {
"body": {
"additionalProperties": false,
"properties": {
"max_mismatches": {
"maximum": 5,
"minimum": 0,
"type": "integer"
},
"phage_sequence": {
"maxLength": 10000,
"minLength": 1,
"pattern": "^[ACGT]+$",
"type": "string"
},
"spacers": {
"items": {
"additionalProperties": false,
"properties": {
"id": {
"maxLength": 128,
"minLength": 1,
"type": "string"
},
"sequence": {
"maxLength": 60,
"minLength": 15,
"pattern": "^[ACGT]+$",
"type": "string"
}
},
"required": [
"id",
"sequence"
],
"type": "object"
},
"maxItems": 50,
"minItems": 1,
"type": "array"
}
},
"required": [
"phage_sequence",
"spacers",
"max_mismatches"
],
"type": "object"
},
"bodyType": {
"enum": [
"json",
"form-data",
"text"
],
"type": "string"
},
"method": {
"enum": [
"POST",
"PUT",
"PATCH"
],
"type": "string"
},
"type": {
"const": "http",
"type": "string"
}
},
"required": [
"type",
"method",
"bodyType",
"body"
],
"type": "object"
}
},
"required": [
"input"
],
"type": "object"
}