ToolAssay

Compares one guide with caller-supplied candidate protospacers, weights mismatch

Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.

Answeringour last check, 2026-09-24
1 of 1checks answered this week
888 msmedian answer time
$0.004listed price per call
$0.004price it asked us

Paid test badge: not yet. The checks above are free: we call the tool without paying and read the payment request it sends back. The Verified badge needs paid calls whose answers match the promised output, and nobody can buy a badge.

Endpoint

POST https://bio.halowerk.com/v1/crispr-offtarget

CategorySearch and research
Provider hostbio.halowerk.com
Networkseip155:8453
Payment schemesexact
Self-reported calls, 30 days2 from 2 payers (the provider's figure, not ours)

Our checks, last 30 days

DayResultHTTPAskedTime
2026-09-24 valid payment request 402$0.004 888 ms

Example input (from the provider)

{
  "body": {
    "candidates": [
      {
        "id": "candidate-1",
        "pam": "AGG",
        "protospacer": "GAGTCCGAGCAGAAGAAGAA"
      },
      {
        "id": "candidate-2",
        "pam": "TGG",
        "protospacer": "GAGTCCGAGCAGAAGATGAA"
      },
      {
        "id": "candidate-3",
        "pam": "TGA",
        "protospacer": "GACTCCGAGCAGAAGAAGAT"
      }
    ],
    "guide": "GAGTCCGAGCAGAAGAAGAA"
  },
  "bodyType": "json",
  "method": "POST",
  "type": "http"
}

Promised output schema (from the provider)

{
  "$schema": "https://json-schema.org/draft/2020-12/schema",
  "properties": {
    "input": {
      "additionalProperties": false,
      "properties": {
        "body": {
          "additionalProperties": false,
          "properties": {
            "candidates": {
              "items": {
                "additionalProperties": false,
                "properties": {
                  "id": {
                    "maxLength": 128,
                    "minLength": 1,
                    "type": "string"
                  },
                  "pam": {
                    "maxLength": 8,
                    "minLength": 2,
                    "pattern": "^[ACGT]+$",
                    "type": "string"
                  },
                  "protospacer": {
                    "maxLength": 30,
                    "minLength": 17,
                    "pattern": "^[ACGT]+$",
                    "type": "string"
                  }
                },
                "required": [
                  "id",
                  "protospacer",
                  "pam"
                ],
                "type": "object"
              },
              "maxItems": 1000,
              "minItems": 1,
              "type": "array"
            },
            "guide": {
              "description": "Guide sequence written 5-prime to 3-prime.",
              "maxLength": 30,
              "minLength": 17,
              "pattern": "^[ACGT]+$",
              "type": "string"
            }
          },
          "required": [
            "guide",
            "candidates"
          ],
          "type": "object"
        },
        "bodyType": {
          "enum": [
            "json",
            "form-data",
            "text"
          ],
          "type": "string"
        },
        "method": {
          "enum": [
            "POST",
            "PUT",
            "PATCH"
          ],
          "type": "string"
        },
        "type": {
          "const": "http",
          "type": "string"
        }
      },
      "required": [
        "type",
        "method",
        "bodyType",
        "body"
      ],
      "type": "object"
    }
  },
  "required": [
    "input"
  ],
  "type": "object"
}

This page as JSON