Compares one guide with caller-supplied candidate protospacers, weights mismatch
Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.
Answeringour last check, 2026-09-24
1 of 1checks answered this week
888 msmedian answer time
$0.004listed price per call
$0.004price it asked us
Paid test badge: not yet. The checks above are free: we call the tool without paying and read the payment request it sends back. The Verified badge needs paid calls whose answers match the promised output, and nobody can buy a badge.
Endpoint
POST https://bio.halowerk.com/v1/crispr-offtarget
| Category | Search and research |
|---|---|
| Provider host | bio.halowerk.com |
| Networks | eip155:8453 |
| Payment schemes | exact |
| Self-reported calls, 30 days | 2 from 2 payers (the provider's figure, not ours) |
Our checks, last 30 days
| Day | Result | HTTP | Asked | Time |
|---|---|---|---|---|
| 2026-09-24 | valid payment request | 402 | $0.004 | 888 ms |
Example input (from the provider)
{
"body": {
"candidates": [
{
"id": "candidate-1",
"pam": "AGG",
"protospacer": "GAGTCCGAGCAGAAGAAGAA"
},
{
"id": "candidate-2",
"pam": "TGG",
"protospacer": "GAGTCCGAGCAGAAGATGAA"
},
{
"id": "candidate-3",
"pam": "TGA",
"protospacer": "GACTCCGAGCAGAAGAAGAT"
}
],
"guide": "GAGTCCGAGCAGAAGAAGAA"
},
"bodyType": "json",
"method": "POST",
"type": "http"
}
Promised output schema (from the provider)
{
"$schema": "https://json-schema.org/draft/2020-12/schema",
"properties": {
"input": {
"additionalProperties": false,
"properties": {
"body": {
"additionalProperties": false,
"properties": {
"candidates": {
"items": {
"additionalProperties": false,
"properties": {
"id": {
"maxLength": 128,
"minLength": 1,
"type": "string"
},
"pam": {
"maxLength": 8,
"minLength": 2,
"pattern": "^[ACGT]+$",
"type": "string"
},
"protospacer": {
"maxLength": 30,
"minLength": 17,
"pattern": "^[ACGT]+$",
"type": "string"
}
},
"required": [
"id",
"protospacer",
"pam"
],
"type": "object"
},
"maxItems": 1000,
"minItems": 1,
"type": "array"
},
"guide": {
"description": "Guide sequence written 5-prime to 3-prime.",
"maxLength": 30,
"minLength": 17,
"pattern": "^[ACGT]+$",
"type": "string"
}
},
"required": [
"guide",
"candidates"
],
"type": "object"
},
"bodyType": {
"enum": [
"json",
"form-data",
"text"
],
"type": "string"
},
"method": {
"enum": [
"POST",
"PUT",
"PATCH"
],
"type": "string"
},
"type": {
"const": "http",
"type": "string"
}
},
"required": [
"type",
"method",
"bodyType",
"body"
],
"type": "object"
}
},
"required": [
"input"
],
"type": "object"
}